Review



scrambled negative control guide rna (mock)  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Synthego Inc scrambled negative control guide rna (mock)
    Scrambled Negative Control Guide Rna (Mock), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scrambled+negative+control+guide+rna+(mock)/negative+control+scrambled+sgrna++modified+++1/pmc12269690-51-9-15
    Average 90 stars, based on 1 article reviews
    scrambled negative control guide rna (mock) - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).

    Sequencing:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).

    Negative Control:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).

    Electroporation:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).

    Expressing:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).

    Flow Cytometry:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).

    Western Blot:

    Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality
    Article Snippet: .. MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).17 MerTK protein expression was assessed after 72 hours by flow cytometry and western blotting. .. Bioenergetics of T cells were analyzed using an XF-96 Extracellular Flux Analyser (Seahorse Bioscience, Agilent).



    Similar Products

    scrambled negative control guide rna (mock)  (Synthego Inc)
    90
    Synthego Inc scrambled negative control guide rna (mock)
    Scrambled Negative Control Guide Rna (Mock), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scrambled+negative+control+guide+rna+(mock)/negative+control+scrambled+sgrna++modified+++1/pmc12269690-51-9-15
    Average 90 stars, based on 1 article reviews
    scrambled negative control guide rna (mock) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    scrambled negative control guide rna (mock) ribonucleoprotein (rnp)  (Synthego Inc)
    90
    Synthego Inc scrambled negative control guide rna (mock) ribonucleoprotein (rnp)
    Scrambled Negative Control Guide Rna (Mock) Ribonucleoprotein (Rnp), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scrambled+negative+control+guide+rna+(mock)/negative+control+scrambled+sgrna++modified+++1/10__1080_slash_2162402x__2025__2532662-50-16-15
    Average 90 stars, based on 1 article reviews
    scrambled negative control guide rna (mock) ribonucleoprotein (rnp) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results